p11-LacY-wtx1
(Plasmid #69056)

• Purpose: The reporter plasmid p11-LacY-wtx1 encodes the toxin CcdB gene under the inducible BAD promoter and a single copy of the endonuclease cleavage site which is readily extendable to multiple copies.
• Depositing Lab: Huimin Zhao
• Publication: Chen et al Nucleic Acids Res. 2005 Oct 6;33(18):e154.

Backbone

• Vector backbone: pBAD18
• Backbone size w/o insert (bp): 4600
• Total vector size (bp): 4600
• Selectable markers: Ampicillin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: ccdB
• Entrez Gene: ccdB (a.k.a. pCoo051)
• Promoter: pBAD

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: SphI (unknown if destroyed)
• 5′ sequencing primer: catgca gctagc GGAGTG aaacgatgcagttt aaggtttacacctataaaaga
• 3′ sequencing primer: agtacg gcatgc cgtatg tctaga ttatattccccaaaacatcaggttaat

Gene/Insert 2

• Gene/Insert name: lacY
• Entrez Gene: lacY (a.k.a. b0343, ECK0340)
• Promoter: pLac
• Tag / Fusion Protein:
  • A177C

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: StuI (unknown if destroyed)
• 3′ cloning site: StuI (unknown if destroyed)
• 5′ sequencing primer: gagctc aggcct gactcactatagggagaccg
• 3′ sequencing primer: ctagct aggccttaagcgacttcattcacct

Resource Information

• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Some users of this plasmid report low DNA yields from DNA preps. Addgene recommends users be aware of this when prepping DNA from this plasmid.