Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p11-LacY-wtx1
(Plasmid #69056)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69056 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBAD18
  • Backbone size w/o insert (bp) 4600
  • Total vector size (bp) 4600
  • Selectable markers
    Ampicillin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    ccdB
  • Entrez Gene
    ccdB (a.k.a. pCoo051)
  • Promoter pBAD

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site SphI (unknown if destroyed)
  • 5′ sequencing primer catgca gctagc GGAGTG aaacgatgcagttt aaggtttacacctataaaaga
  • 3′ sequencing primer agtacg gcatgc cgtatg tctaga ttatattccccaaaacatcaggttaat
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    lacY
  • Entrez Gene
    lacY (a.k.a. b0343, ECK0340)
  • Promoter pLac
  • Tag / Fusion Protein
    • A177C

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site StuI (unknown if destroyed)
  • 3′ cloning site StuI (unknown if destroyed)
  • 5′ sequencing primer gagctc aggcct gactcactatagggagaccg
  • 3′ sequencing primer ctagct aggccttaagcgacttcattcacct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Some users of this plasmid report low DNA yields from DNA preps. Addgene recommends users be aware of this when prepping DNA from this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p11-LacY-wtx1 was a gift from Huimin Zhao (Addgene plasmid # 69056 ; http://n2t.net/addgene:69056 ; RRID:Addgene_69056)
  • For your References section:

    A highly sensitive selection method for directed evolution of homing endonucleases. Chen Z, Zhao H. Nucleic Acids Res. 2005 Oct 6;33(18):e154. 10.1093/nar/gni148 PubMed 16214805