pLKO-RFP-IKZF1-sh2
(Plasmid
#69041)
-
Purpose3rd generation lentiviral vector expressing IKZF1 shRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69041 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO-RFP
-
Backbone manufacturerDr. Julie Losman
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameIKZF1
-
Alt nameIKAROS family zinc finger 1
-
gRNA/shRNA sequenceCTACGAGAAGGAGAACGAAAT
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-RFP-IKZF1-sh2 was a gift from William Kaelin (Addgene plasmid # 69041 ; http://n2t.net/addgene:69041 ; RRID:Addgene_69041) -
For your References section:
The myeloma drug lenalidomide promotes the cereblon-dependent destruction of Ikaros proteins. Lu G, Middleton RE, Sun H, Naniong M, Ott CJ, Mitsiades CS, Wong KK, Bradner JE, Kaelin WG Jr. Science. 2014 Jan 17;343(6168):305-9. doi: 10.1126/science.1244917. Epub 2013 Nov 29. 10.1126/science.1244917 PubMed 24292623