Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pES003 (pTet-qacR 2)
(Plasmid #69032)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69032 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p15A Ori/cm resistant
  • Backbone manufacturer
    unknown
  • Backbone size w/o insert (bp) 1154
  • Total vector size (bp) 3117
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    qacR
  • Species
    Synthetic
  • Insert Size (bp)
    596
  • Mutation
    E57Q, E58L, W61Y, E90Q, I99Q, M116Q, L119Y, E120Q, N154M, N157L, T161M
  • Entrez Gene
    qacR (a.k.a. pTZ2162_28)
  • Promoter pTet
  • Tag / Fusion Protein
    • His6 tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GCTTATCATCGATAAGCTTCC
  • 3′ sequencing primer CGCCCGGTAGTGATCTTAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pES003 (pTet-qacR 2) was a gift from Richard Murray (Addgene plasmid # 69032 ; http://n2t.net/addgene:69032 ; RRID:Addgene_69032)
  • For your References section:

    Engineering Transcriptional Regulator Effector Specificity Using Computational Design and In Vitro Rapid Prototyping: Developing a Vanillin Sensor. de Los Santos EL, Meyerowitz JT, Mayo SL, Murray RM. ACS Synth Biol. 2015 Aug 19. 10.1021/acssynbio.5b00090 PubMed 26262913