pES001 (pQacA-deGFP)
(Plasmid #69030)

• Purpose: Reporter Plasmid - deGFP driven by a qacR responsive promoter
• Depositing Lab: Richard Murray
• Publication: de Los Santos et al ACS Synth Biol. 2015 Aug 19.

Backbone

• Vector backbone: p15A Ori/cm resistant
• Backbone manufacturer: unknown
• Backbone size w/o insert (bp): 1154
• Total vector size (bp): 3072
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: deGFP
• Alt name: eGFP-Del6-229
• Species: Synthetic
• Insert Size (bp): 1917
• Promoter: qacA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: GCTTATCATCGATAAGCTTCC
• 3′ sequencing primer: CGCCCGGTAGTGATCTTAT

Resource Information

• Supplemental Documents:
  • pQacA-deGFP
• A portion of this plasmid was derived from a plasmid made by: Original deGFP gene was cloned from (Addgene Plasmid #40019)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry