Cx26-sfGFP
(Plasmid
#69026)
-
PurposeExpresses rat Cx26 (Gjb2 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to non-monomerized superfolder GFP. Expression driven by CMV promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69026 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneEGFP-N1
- Total vector size (bp) 5350
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCx26
-
SpeciesR. norvegicus (rat)
-
Entrez GeneGjb2 (a.k.a. CXN-26, Cx26)
- Promoter CMV
-
Tag
/ Fusion Protein
- non-monomerized superfolder GFP (V206) (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV
- 3′ sequencing primer C1N1-rev: ACCTCTACAAATGTGGTATGGCTGATTATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cx26-sfGFP was a gift from David Spray (Addgene plasmid # 69026 ; http://n2t.net/addgene:69026 ; RRID:Addgene_69026) -
For your References section:
Connexin Type and Fluorescent Protein-fusion Tag Determine Structural Stability of Gap Junction Plaques. Stout RF Jr, Snapp EL, Spray DC. J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979. 10.1074/jbc.M115.659979 PubMed 26265468