Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

sfGFP-Cx43K258stop
(Plasmid #69025)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69025 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    EGFP-C1
  • Total vector size (bp) 5514
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cx43
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    768
  • Mutation
    non-monomerized sfGFP fused in frame to N-terminus of truncated Cx43delete codons 258-381 of the Cx43 CDS
  • Entrez Gene
    Gja1 (a.k.a. Cx43, Cxnk1)
  • Promoter CMV
  • Tag / Fusion Protein
    • super folder GFP (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CMV
  • 3′ sequencing primer C1N1-rev: ACCTCTACAAATGTGGTATGGCTGATTATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note all connexins tested that have a fluorescent protein fused to the connexin amino-terminus do not form functional channels. This plasmid forms gap junction plaque structures but does not produce intercellular coupling.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sfGFP-Cx43K258stop was a gift from David Spray (Addgene plasmid # 69025 ; http://n2t.net/addgene:69025 ; RRID:Addgene_69025)
  • For your References section:

    Connexin Type and Fluorescent Protein-fusion Tag Determine Structural Stability of Gap Junction Plaques. Stout RF Jr, Snapp EL, Spray DC. J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979. 10.1074/jbc.M115.659979 PubMed 26265468