Cx43K258stop-msfGFP
(Plasmid #69023)

• Purpose: Expresses rat Cx43 (Gja1 CDS) truncated at amino acid 258 and tagged with msfGFP on the C-terminus. CMV promoter.
• Depositing Lab: David Spray
• Publication: Stout RF et al J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979.

Backbone

• Vector backbone: EGFP-N1
• Total vector size (bp): 5518
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): JM109
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cx43
• Species: R. norvegicus (rat)
• Insert Size (bp): 768
• Mutation: delete codons 258-381 and fuse in frame to monomeric superfolder GFP
• Entrez Gene: Gja1 (a.k.a. Cx43, Cxnk1)
• Promoter: CMV
• Tag / Fusion Protein:
  • V206K monomerized super folder GFP (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CMV
• 3′ sequencing primer: C1N1-rev: ACCTCTACAAATGTGGTATGGCTGATTATG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addition of a fluorescent protein tag to the carboxyl-terminus of Cx43 has been shown to eliminate or attenuate interactions with ZO-1 and Occludin in cell culture. Other binding interactions and channel gating properties may be affected.