EBFP2-Cx26
(Plasmid #69021)

• Purpose: Expresses rat Cx26 (Gjb2 CDS) with an 8 amino acid linker on the N-terminus of the Connexin linking to Enhanced Blue Fluorescent Protein 2 (FP fused to NT of connexin). CMV promoter.
• Depositing Lab: David Spray
• Publication: Stout RF et al J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979.

Backbone

• Vector backbone: EGFP-C1
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): JM109
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Gja2
• Alt name: Cx26
• Species: R. norvegicus (rat)
• Entrez Gene: Gjb2 (a.k.a. CXN-26, Cx26)
• Entrez Gene: Cx26
• Promoter: CMV
• Tag / Fusion Protein:
  • EBFP2 (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CAGATGGATTGGGGCACACTAC
• 3′ sequencing primer: ACCTCTACAAATGTGGTATGGCTGATTATG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note all connexins tested that have a fluorescent protein fused to the connexin amino-terminus do not form functional channels. This plasmid forms gap junction plaque structures but does not produce intercellular coupling.