EBFP2-Cx43
(Plasmid #69020)

• Purpose: Expresses rat Cx43 (Gja1 CDS) with an 8 amino acid linker on the N-terminus of the Connexin linking to Enhanced Blue Fluorescent Protein 2 (FP fused to NT of connexin). CMV promoter.
• Depositing Lab: David Spray
• Publication: Stout RF et al J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979.

Backbone

• Vector backbone: EGFP-C1
• Total vector size (bp): 5888
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): JM109
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cx43
• Species: R. norvegicus (rat)
• Insert Size (bp): 1146
• Entrez Gene: Gja1 (a.k.a. Cx43, Cxnk1)
• Promoter: CMV
• Tag / Fusion Protein:
  • EBFP2 (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CMV
• 3′ sequencing primer: C1N1-rev: ACCTCTACAAATGTGGTATGGCTGATTATG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note all connexins tested that have a fluorescent protein fused to the connexin amino-terminus do not form functional channels. This plasmid forms gap junction plaque structures but does not produce intercellular coupling.