Cx30-msfGFP
(Plasmid #69019)

• Purpose: Expresses human Cx30 (GJB6 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.
• Depositing Lab: David Spray
• Publication: Stout RF et al J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979.

Backbone

• Vector backbone: EGFP-N1
• Total vector size (bp): 5350
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): JM109
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cx30
• Species: H. sapiens (human)
• Entrez Gene: GJB6 (a.k.a. CX30, DFNA3, DFNA3B, DFNB1B, ECTD2, ED2, EDH, HED, HED2)
• Promoter: c
• Tag / Fusion Protein:
  • V206K monomerized super folder GFP (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: EGFP-N: CGTCGCCGTCCAGCTCGACCAG
• 3′ sequencing primer: C1N1-rev: ACCTCTACAAATGTGGTATGGCTGATTATG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry