Cx43-msfGFP
(Plasmid #69007)

• Purpose: Expresses rat Cx43 (Gja1 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.
• Depositing Lab: David Spray
• Publication: Stout RF et al J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979.

Backbone

• Vector backbone: EGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4733
• Total vector size (bp): 5893
• Modifications to backbone: EGFP replaced with sfGFP and the V207 in sfGFP mutagenized to K with PCR cloning to monomerize.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): JM109
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Gja1
• Alt name: Cx43
• Species: R. norvegicus (rat)
• Entrez Gene: Gja1 (a.k.a. Cx43, Cxnk1)
• Promoter: cmv
• Tag / Fusion Protein:
  • monomerized superfolder GFP (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CMV forward primer
• 3′ sequencing primer: ACCTCTACAAATGTGGTATGGCTGATTATG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addition of a fluorescent protein tag to the carboxyl-terminus of Cx43 has been shown to eliminate or attenuate interactions with ZO-1 and Occludin in cell culture. Other binding interactions and channel gating properties may be affected.