mhc2dab:GFP-LT
(Plasmid
#68996)
-
Purposefor making transgenic fish
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68996 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemTol2-GFP-LT
-
Vector typeZebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemhc2dab
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)3800
-
GenBank IDAL928944.8
-
Entrez Genemhc2dab (a.k.a. DAB, DAB1, dab1*01, dab101, dab2*01, dab201, dab3*01, dab301, dab4*01, dab4*02, dab401, dab402, mhc2d8.37b3, mhc2deb, si:dkeyp-2h4.1, zgc:110349, zgc:152682)
- Promoter mhc2dab
-
Tag
/ Fusion Protein
- GFP-LT (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer GAGCGGCCGCCTTAGTGTATGTACGAGTGTATAGATGTTTCCC
- 3′ sequencing primer GAGGATCCGAGTCTTTGAATGTGTCAAATGAAGAACTTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A 3.8-kb fragment upstream of the mhc2dab transcriptional start site was amplified from the bacmid AL928944
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mhc2dab:GFP-LT was a gift from David Traver (Addgene plasmid # 68996 ; http://n2t.net/addgene:68996 ; RRID:Addgene_68996) -
For your References section:
Characterization of the mononuclear phagocyte system in zebrafish. Wittamer V, Bertrand JY, Gutschow PW, Traver D. Blood. 2011 Jun 30;117(26):7126-35. doi: 10.1182/blood-2010-11-321448. Epub 2011 Mar 15. 10.1182/blood-2010-11-321448 PubMed 21406720