pAAV-MCS-shCHD5 #2
(Plasmid
#68877)
-
PurposeCHD5 shRNA expressed from Adeno-associated viral (AAV) vector
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68877 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-MCS-CMV-eGFP
-
Backbone manufacturerStratagene
-
Vector typeMammalian Expression, AAV, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCHD5
-
gRNA/shRNA sequenceCGCAAGCAGGTCAACTACAAT
-
SpeciesM. musculus (mouse)
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-MCS-shCHD5 #2 was a gift from Adrian Bracken (Addgene plasmid # 68877 ; http://n2t.net/addgene:68877 ; RRID:Addgene_68877) -
For your References section:
CHD5 is required for neurogenesis and has a dual role in facilitating gene expression and polycomb gene repression. Egan CM, Nyman U, Skotte J, Streubel G, Turner S, O'Connell DJ, Rraklli V, Dolan MJ, Chadderton N, Hansen K, Farrar GJ, Helin K, Holmberg J, Bracken AP. Dev Cell. 2013 Aug 12;26(3):223-36. doi: 10.1016/j.devcel.2013.07.008. 10.1016/j.devcel.2013.07.008 PubMed 23948251
Map uploaded by the depositor.