Addgene: pAAV-MCS-shCHD5 #2 Skip to main content
Addgene

pAAV-MCS-shCHD5 #2
(Plasmid #68877)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68877 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-MCS-CMV-eGFP
  • Backbone manufacturer
    Stratagene
  • Vector type
    Mammalian Expression, AAV, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CHD5
  • gRNA/shRNA sequence
    CGCAAGCAGGTCAACTACAAT
  • Species
    M. musculus (mouse)
  • Promoter H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-MCS-shCHD5 #2 was a gift from Adrian Bracken (Addgene plasmid # 68877 ; http://n2t.net/addgene:68877 ; RRID:Addgene_68877)
  • For your References section:

    CHD5 is required for neurogenesis and has a dual role in facilitating gene expression and polycomb gene repression. Egan CM, Nyman U, Skotte J, Streubel G, Turner S, O'Connell DJ, Rraklli V, Dolan MJ, Chadderton N, Hansen K, Farrar GJ, Helin K, Holmberg J, Bracken AP. Dev Cell. 2013 Aug 12;26(3):223-36. doi: 10.1016/j.devcel.2013.07.008. 10.1016/j.devcel.2013.07.008 PubMed 23948251