Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCS6-YFP-SMASh
(Plasmid #68853)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68853 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCS6
  • Backbone size w/o insert (bp) 6622
  • Total vector size (bp) 8260
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    YFP-SMASh
  • Species
    HCV, Aequorea victoria
  • Insert Size (bp)
    1638
  • Promoter CMV
  • Tag / Fusion Protein
    • SMASh tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTTAGGTGACACTATAG
  • 3′ sequencing primer CAGGCTGGGTCCTGTCACTGGCTAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS6-YFP-SMASh was a gift from Michael Lin (Addgene plasmid # 68853 ; http://n2t.net/addgene:68853 ; RRID:Addgene_68853)
  • For your References section:

    Tunable and reversible drug control of protein production via a self-excising degron. Chung HK, Jacobs CL, Huo Y, Yang J, Krumm SA, Plemper RK, Tsien RY, Lin MZ. Nat Chem Biol. 2015 Jul 27. doi: 10.1038/nchembio.1869. 10.1038/nchembio.1869 PubMed 26214256