-
PurposeExpresses SMASh tag fused to YFP at C terminus in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68853 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCS6
- Backbone size w/o insert (bp) 6622
- Total vector size (bp) 8260
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYFP-SMASh
-
SpeciesHCV, Aequorea victoria
-
Insert Size (bp)1638
- Promoter CMV
-
Tag
/ Fusion Protein
- SMASh tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTAGGTGACACTATAG
- 3′ sequencing primer CAGGCTGGGTCCTGTCACTGGCTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS6-YFP-SMASh was a gift from Michael Lin (Addgene plasmid # 68853 ; http://n2t.net/addgene:68853 ; RRID:Addgene_68853) -
For your References section:
Tunable and reversible drug control of protein production via a self-excising degron. Chung HK, Jacobs CL, Huo Y, Yang J, Krumm SA, Plemper RK, Tsien RY, Lin MZ. Nat Chem Biol. 2015 Jul 27. doi: 10.1038/nchembio.1869. 10.1038/nchembio.1869 PubMed 26214256