myc-hRAD18 C207F
(Plasmid
#68829)
-
PurposeExpresses c-myc-tagged human RAD18 with C207F mutation
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68829 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAGGS
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namec-myc tagged human RAD18 with C207F mutation
-
Alt namemyc hRAD18 C207F
-
SpeciesH. sapiens (human)
-
Entrez GeneRAD18 (a.k.a. RNF73)
- Promoter CAG
-
Tag
/ Fusion Protein
- c-myc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GCTTCTGGCGTGTGACC
- 3′ sequencing primer GTATTTGTGAGCCAGGGCAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
myc-hRAD18 C207F was a gift from Satoshi Tateishi (Addgene plasmid # 68829 ; http://n2t.net/addgene:68829 ; RRID:Addgene_68829) -
For your References section:
RAD18 promotes DNA double-strand break repair during G1 phase through chromatin retention of 53BP1. Watanabe K, Iwabuchi K, Sun J, Tsuji Y, Tani T, Tokunaga K, Date T, Hashimoto M, Yamaizumi M, Tateishi S. Nucleic Acids Res. 2009 Apr;37(7):2176-93. doi: 10.1093/nar/gkp082. Epub 2009 Feb 19. 10.1093/nar/gkp082 PubMed 19228710