Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

myc-hRAD18
(Plasmid #68827)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68827 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAGGS
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    c-myc tagged human RAD18
  • Alt name
    myc hRAD18
  • Species
    H. sapiens (human)
  • Entrez Gene
    RAD18 (a.k.a. RNF73)
  • Promoter CAG
  • Tag / Fusion Protein
    • c-myc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GCTTCTGGCGTGTGACC
  • 3′ sequencing primer GTATTTGTGAGCCAGGGCAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    myc-hRAD18 was a gift from Satoshi Tateishi (Addgene plasmid # 68827 ; http://n2t.net/addgene:68827 ; RRID:Addgene_68827)
  • For your References section:

    RAD18 promotes DNA double-strand break repair during G1 phase through chromatin retention of 53BP1. Watanabe K, Iwabuchi K, Sun J, Tsuji Y, Tani T, Tokunaga K, Date T, Hashimoto M, Yamaizumi M, Tateishi S. Nucleic Acids Res. 2009 Apr;37(7):2176-93. doi: 10.1093/nar/gkp082. Epub 2009 Feb 19. 10.1093/nar/gkp082 PubMed 19228710