pX330-sgRNA_Dicer_1
(Plasmid #68807)

• Purpose: specific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of Dicer1 knockout mESCs.
• Depositing Lab: Constance Ciaudo
• Publication: Bodak et al FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Backbone manufacturer: Addgene 42230
• Backbone size w/o insert (bp): 8506
• Total vector size (bp): 8509
• Vector type: Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA mouse Dicer1
• gRNA/shRNA sequence: mouse Dicer1
• Species: M. musculus (mouse)
• GenBank ID: 23405

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: agggatggttggttggtggg
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry