Skip to main content
Addgene

pQCXIP-BSR-GFP11
(Plasmid #68716)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68716 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pQCXIP
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin, Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    bsr
  • Alt name
    Blasticidin S-resistance gene
  • Species
    Bacillus cereus
  • Tags / Fusion Proteins
    • GFP11 (C terminal on insert)
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer tttccgggccctcacattgccaaa
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Overall this plasmid contains bsr-GFP11-ires-puromycin resistance gene. GFP11 covers the 11th strand of GFP and the sequence is ctgcagcgcgatcacatggtcctgcacgagtacgtgaacgccgccgggatcact.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQCXIP-BSR-GFP11 was a gift from Yutaka Hata (Addgene plasmid # 68716 ; http://n2t.net/addgene:68716 ; RRID:Addgene_68716)

  • For your References section:

    A new cell-based assay to evaluate myogenesis in mouse myoblast C2C12 cells. Kodaka M, Yang Z, Nakagawa K, Maruyama J, Xu X, Sarkar A, Ichimura A, Nasu Y, Ozawa T, Iwasa H, Ishigami-Yuasa M, Ito S, Kagechika H, Hata Y. Exp Cell Res. 2015 Aug 15;336(2):171-81. doi: 10.1016/j.yexcr.2015.06.015. Epub 2015 Jun 24. 10.1016/j.yexcr.2015.06.015 PubMed 26116467
Related items:
Commonly requested with: