tdTomato/pTREX-b
(Plasmid #68709)

• Purpose: Expresses tdTomato in pTREX-b vector which confers resistance to blasticidin. This vector is used for cloning a specific sgRNA by BamHI, to transfect Cas9-expressing Trypanosoma cruzi epimastigotes.
• Depositing Lab: Roberto Docampo
• Publication: Lander et al MBio. 2015 Jul 21;6(4). pii: e01012-15. doi: 10.1128/mBio.01012-15.

Backbone

• Vector backbone: pTREX-b
• Backbone manufacturer: Vazquez and Levin., 1999
• Backbone size w/o insert (bp): 5900
• Total vector size (bp): 7300
• Modifications to backbone: tdTomato synthetic gene (1431 bp) was cloned by restriction sites XbaI and HindIII into pTREX-b (with blasticidin resistance marker).
• Vector type: Expression of tdTomato red fluorescence protein in Trypanosoma cruzi
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tdTomato
• Species: Synthetic
• Insert Size (bp): 1431

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: 5’- CAATTCTAGAATGGTTTCCAAGGGTGAGGA -3’
• 3′ sequencing primer: 5’- GCAGAAGCTTTTACTTGTACAACTCGTCCA -3’

Resource Information

• Supplemental Documents:
  • sgRNA/tdTomato/pTREX-b vector map (idem to tdTomato/pTREX-b vector but containing a sgRNA sequence
• A portion of this plasmid was derived from a plasmid made by: This gene was subcloned by Dr. Noelia Lander in my laboratory.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry