Skip to main content
Addgene

pOPTXGARE
(Plasmid #68542)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68542 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLUC Trap3 (GW)
  • Backbone manufacturer
    Calderon-Villalobos et al 2006 Plant Physiol 141:3-14 (GenBank: AY968054.1)
  • Backbone size w/o insert (bp) 7272
  • Total vector size (bp) 8300
  • Vector type
    Bacterial Expression, Plant Expression
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    OPTX promoter with GARE
  • Alt name
    NTL1 promoter with GARE
  • Alt name
    AT1G33440
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    1080
  • Mutation
    5x GARE inserted 190 bp 5' pf ATG (GARE = taacaaa)
  • GenBank ID
    NM_102069.3
  • Entrez Gene
    AT1G33440 (a.k.a. AT1G33440, F10C21.11, F10C21_11)
  • Promoter OPTX promoter with GARE
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pBR322ori-F GGGAAACGCCTGGTATCTTT
  • 3′ sequencing primer lucNRev
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

linker sequence between inserted GARE is 5' gagagcc 3'

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOPTXGARE was a gift from Helen Irving (Addgene plasmid # 68542 ; http://n2t.net/addgene:68542 ; RRID:Addgene_68542)
  • For your References section:

    A cyclic nucleotide sensitive promoter reporter system suitable for bacteria and plant cells. Wheeler JI, Freihat L, Irving HR. BMC Biotechnol. 2013 Nov 9;13:97. doi: 10.1186/1472-6750-13-97. 10.1186/1472-6750-13-97 PubMed 24206622