pOPTXcGMPRELUC
(Plasmid #68503)

• Purpose: cyclic nucleotide reporter for bacteria or plant cells
• Depositing Lab: Helen Irving
• Publication: Wheeler et al BMC Biotechnol. 2013 Nov 9;13:97. doi: 10.1186/1472-6750-13-97.

Backbone

• Vector backbone: pLUC Trap3 (GW)
• Backbone manufacturer: Calderon-Villalobos et al 2006 Plant Physiol 141:3-14 (GenBank: AY968054.1)
• Backbone size w/o insert (bp): 7272
• Total vector size (bp): 8300
• Vector type: Bacterial Expression, Plant Expression
• Selectable markers: Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: OPTX promoter with cGMPRE
• Alt name: NTL1 promoter with cGMPRE
• Alt name: AT1G33440
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 1054
• Mutation: 3x cGMPRE inserted 190bp 5' of ATG (cGMPRE = aaatagatttcaacagtt)
• GenBank ID:
• Entrez Gene: AT1G33440 (a.k.a. AT1G33440, F10C21.11, F10C21_11)
• Promoter: OPTX promoter with cGMPRE
• Tag / Fusion Protein:
  • luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: pBR322ori-F GGGAAACGCCTGGTATCTTT
• 3′ sequencing primer: lucNRev

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry