hCas9-VPR
(Plasmid #68497)

• Purpose: nuclease competent SP-Cas9 fused to VPR
• Depositing Lab: George Church
• Publication: Kiani et al Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580.

Backbone

• Vector backbone: hCas9 Plasmid #41815
• Total vector size (bp): 11319
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SP-Cas9-VPR
• Species: Synthetic
• Insert Size (bp): 5799
• Promoter: CMV
• Tag / Fusion Protein:
  • VPR (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCAAGTACTTCGACACCACCA
• 3′ sequencing primer: AACACCCGTGCGTTTTATTC

Resource Information

• Supplemental Documents:
  • nuclease competent SP-Cas9 fused to VPR
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry