-
PurposeAAV vector containing SaCas9 fused to VPR
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA Plasmid #61592
-
Backbone manufacturerFeng Zhang
- Total vector size (bp) 8613
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSaCas9-VPR
-
Alt nameSauCas9-VPR
-
SpeciesSynthetic; Staphylococcus aureus
-
Insert Size (bp)4857
- Promoter CMV
-
Tag
/ Fusion Protein
- VPR (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTACTACGAAGTGAATAGCAAGTGC
- 3′ sequencing primer ACTCAGACAATGCGATGCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV_NLS-SaCas9-NLS-VPR was a gift from George Church (Addgene plasmid # 68496 ; http://n2t.net/addgene:68496 ; RRID:Addgene_68496) -
For your References section:
Cas9 gRNA engineering for genome editing, activation and repression. Kiani S, Chavez A, Tuttle M, Hall RN, Chari R, Ter-Ovanesyan D, Qian J, Pruitt BW, Beal J, Vora S, Buchthal J, Kowal EJ, Ebrahimkhani MR, Collins JJ, Weiss R, Church G. Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580. 10.1038/nmeth.3580 PubMed 26344044
