Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MSCV Puro
(Plasmid #68469)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68469 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MSCV
  • Total vector size (bp) 6295
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Puromycin Resistance
  • Alt name
    PuroR
  • Insert Size (bp)
    603
  • Promoter pGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer GAATTCTACCGGGTAGGGGAG
  • 3′ sequencing primer ATCGATGCATGGGGTCGTGCGCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV Puro was a gift from Tyler Jacks (Addgene plasmid # 68469 ; http://n2t.net/addgene:68469 ; RRID:Addgene_68469)
  • For your References section:

    A Modular Assembly Platform for Rapid Generation of DNA Constructs. Akama-Garren EH, Joshi NS, Tammela T, Chang GP, Wagner BL, Lee DY, Rideout Iii WM, Papagiannakopoulos T, Xue W, Jacks T. Sci Rep. 2016 Feb 18;6:16836. doi: 10.1038/srep16836. 10.1038/srep16836 PubMed 26887506