Cas9-2A-Cre
(Plasmid #68468)

• Purpose: co-expressing Cas9 and Cre recombinase
• Depositing Lab: Su-Chun Zhang
• Publication: Chen et al Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001.

Backbone

• Vector backbone: Cas9-2A-GFP
• Modifications to backbone: Cas9-2A-Cre was constructed by replacing GFP in the Cas9-2A-GFP (Addgene plasmid #44719) with the Cre cDNA amplified frompCAG-Cre (Addgene plasmid #13775)
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9 and Cre recombinase
• Species: H. sapiens (human)
• Insert Size (bp): 5288
• Promoter: CAG
• Tag / Fusion Protein:
  • P2A-Cre-Myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: ggctctagtgcctctgctaacc
• 3′ sequencing primer: M13R

Resource Information

• Supplemental Documents:
  • Cas9-2A-Cre map
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry