AAVS1-Blasticidin-CAG-Flpe-ERT2
(Plasmid #68461)

• Purpose: AAVS1 targeting donor plasmid with Flpe-ERT2 expression cassette and blasticidin selection gene
• Depositing Lab: Su-Chun Zhang
• Publication: Chen et al Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001.

Backbone

• Vector backbone: AAVS1-CAG
• Backbone size w/o insert (bp): 8085
• Total vector size (bp): 12382
• Modifications to backbone: amplified mammalian-codon-optimized Flpe recombinase cDNA and ERT2 cDNA by PCR from pDIRE (Addgene plasmid #26745) and pCAG-FlpeERT2 (Addgene plasmid #14756), respectively. The mammalian codon-optimized Flpe fused with ERT2 was inserted into the AAVS1-neo-CAG-hrGFP to replace GFP to get the AAVS1-neo-CAG-FlpeERT2 donor plasmid.
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mammalian-codon-optimized Flpe recombinase fused with ERT2
• Species: Synthetic
• Insert Size (bp): 2243
• Promoter: CAG
• Tag / Fusion Protein:
  • ERT2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: ggcttctggcgtgtgaccggc
• 3′ sequencing primer: catagcgtaaaaggagcaaca

Resource Information

• Supplemental Documents:
  • AAVS1-blasticidin-CAG-Flpe-ERT2
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry