-
PurposeTOPO construct expressing Cre-2A-GFP for generation of GMAP-compatible gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68450 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneTOPO 2-5
- Backbone size w/o insert (bp) 3524
-
Vector typeBacterial Expression ; GMAP
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre-2A-GFP
-
Insert Size (bp)1850
- Promoter Plac
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTAACTCGAACGCTAGCTGTGCGATCGTTT
- 3′ sequencing primer AGAGTAATTCAACCCCAAACAACAACGTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TOPO Cre-2A-GFP was a gift from Tyler Jacks (Addgene plasmid # 68450 ; http://n2t.net/addgene:68450 ; RRID:Addgene_68450) -
For your References section:
A Modular Assembly Platform for Rapid Generation of DNA Constructs. Akama-Garren EH, Joshi NS, Tammela T, Chang GP, Wagner BL, Lee DY, Rideout Iii WM, Papagiannakopoulos T, Xue W, Jacks T. Sci Rep. 2016 Feb 18;6:16836. doi: 10.1038/srep16836. 10.1038/srep16836 PubMed 26887506