pCMV/3' Box_(GLuc)_INT
(Plasmid #68436)

• Purpose: Transient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. CMV/3' Box expression backbone.
• Depositing Lab: John Rinn
• Publication: Shechner et al Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1.

Backbone

• Vector backbone: pNEB193
• Backbone manufacturer: NEB
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: INT construct_bearing three PP7 Stem-loops
• gRNA/shRNA sequence: gRNA: GATCTAGATACGACTCACTAT
• Species: Synthetic
• Promoter: CMV

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: M13R

Resource Information

• Supplemental Documents:
  • pCMV/3' Box_(GLuc)_INT genbank

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a casette of PP7 stem-loops. Trascription termination is by the U1 snRNA 3' Box system.