pCMV/3' Box_(GLuc)_TOP2
(Plasmid #68435)

• Purpose: Transient expression of the "TOP2" construct, targeting the GLuc reporter, in mammalian cells. CMV/3' Box expression backbone.
• Depositing Lab: John Rinn
• Publication: Shechner et al Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1.

Backbone

• Vector backbone: pNEB193
• Backbone manufacturer: NEB
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TOP2 construct
• gRNA/shRNA sequence: gRNA: GATCTAGATACGACTCACTAT
• Species: Synthetic
• Promoter: CMV

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: M13R

Resource Information

• Supplemental Documents:
  • pCMV/3' Box_(GLuc)_TOP2 genbank

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sgRNA core targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains a 5'-"accessory domain," comprising the T. thermophilia P4-P6 domain appended with a casette of PP7 stem-loops. Trascription termination is by the U1 snRNA 3'Box system.