pU6_(GLuc)_INT[3xPP7_SL]
(Plasmid #68424)

• Purpose: Transient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U6 promoter
• Depositing Lab: John Rinn
• Publication: Shechner et al Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1.

Backbone

• Vector backbone: pNEB193
• Backbone manufacturer: NEB
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: INT construct bearing three PP7 Stem-loops
• Alt name: Gluc sgRNA with accessory domain added
• gRNA/shRNA sequence: gRNA: GATCTAGATACGACTCACTAT
• Species: Synthetic
• Promoter: human U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: LKO.1 5
• 3′ sequencing primer: M13R

Resource Information

• Supplemental Documents:
  • pU6_(GLuc)_INT[3xPP7_SL] genbank
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a casette of PP7 stem-loops