Skip to main content
Addgene

pLenti_9xD3B_Cluc_Norm
(Plasmid #68414)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68414 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti6.3/TO/V5-DEST
  • Backbone manufacturer
    Life Technologies
  • Vector type
    Lentiviral, Luciferase
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cypridina Luciferase-2A-Venus YFP
  • Mutation
    YFP: M153T,V163A,S175G ("Venus") YFP Variant
  • Promoter minimalCMV

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Reporters are separated by 2A "self-cleaving" peptides. The reporter cassette is under the control of a minimal CMV promoter, preceeded by a casette of nine (ATCTAGATCGCCCGTCCCCT)AGG sites. The Tet-reponsive promoter and Gateway cloning sites were removed from the parent vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti_9xD3B_Cluc_Norm was a gift from John Rinn (Addgene plasmid # 68414 ; http://n2t.net/addgene:68414 ; RRID:Addgene_68414)
  • For your References section:

    Multiplexable, locus-specific targeting of long RNAs with CRISPR-Display. Shechner DM, Hacisuleyman E, Younger ST, Rinn JL. Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1. 10.1038/nmeth.3433 PubMed 26030444