pLenti_9xD3B_Cluc_Norm
(Plasmid #68414)

• Purpose: CRISPR-Display Cypridina Luciferase-2A-Venus YFP "normalizer," lentiviral format.
• Depositing Lab: John Rinn
• Publication: Shechner et al Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1.

Backbone

• Vector backbone: pLenti6.3/TO/V5-DEST
• Backbone manufacturer: Life Technologies
• Vector type: Lentiviral, Luciferase
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cypridina Luciferase-2A-Venus YFP
• Mutation: YFP: M153T,V163A,S175G ("Venus") YFP Variant
• Promoter: minimalCMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: LNCX
• 3′ sequencing primer: EGFP-N

Resource Information

• Supplemental Documents:
  • pLenti_9xD3B_Cluc_Norm

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Reporters are separated by 2A "self-cleaving" peptides. The reporter cassette is under the control of a minimal CMV promoter, preceeded by a casette of nine (ATCTAGATCGCCCGTCCCCT)AGG sites. The Tet-reponsive promoter and Gateway cloning sites were removed from the parent vector.