Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pmirGLO-Calb2-3'UTR
(Plasmid #68363)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68363 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmirGLO
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 7350
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Calb2 3'UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    571
  • Mutation
    C to T change in UTR
  • GenBank ID
    794
  • Entrez Gene
    CALB2 (a.k.a. CAB29, CAL2, CR)
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer Fluc-F1 AGAAGCTGCGCGGTGGTGTTGTG
  • 3′ sequencing primer EBV reverse
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmirGLO-Calb2-3'UTR was a gift from Emanuela Felley-Bosco & Rolf Stahel (Addgene plasmid # 68363 ; http://n2t.net/addgene:68363 ; RRID:Addgene_68363)
  • For your References section:

    Posttranscriptional Regulation Controls Calretinin Expression in Malignant Pleural Mesothelioma. Kresoja-Rakic J, Sulemani M, Kirschner MB, Ronner M, Reid G, Kao S, Schwaller B, Weder W, Stahel RA, Felley-Bosco E. Front Genet. 2017 May 29;8:70. doi: 10.3389/fgene.2017.00070. eCollection 2017. 10.3389/fgene.2017.00070 PubMed 28611824