pmirGLO-Calb2-3'UTR
(Plasmid
#68363)
-
PurposeLuciferase miRNA Target Expression Vector
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmirGLO
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 7350
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCalb2 3'UTR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)571
-
MutationC to T change in UTR
-
GenBank ID794
-
Entrez GeneCALB2 (a.k.a. CAB29, CAL2, CR)
-
Tag
/ Fusion Protein
- luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer Fluc-F1 AGAAGCTGCGCGGTGGTGTTGTG
- 3′ sequencing primer EBV reverse (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmirGLO-Calb2-3'UTR was a gift from Emanuela Felley-Bosco & Rolf Stahel (Addgene plasmid # 68363 ; http://n2t.net/addgene:68363 ; RRID:Addgene_68363) -
For your References section:
Posttranscriptional Regulation Controls Calretinin Expression in Malignant Pleural Mesothelioma. Kresoja-Rakic J, Sulemani M, Kirschner MB, Ronner M, Reid G, Kao S, Schwaller B, Weder W, Stahel RA, Felley-Bosco E. Front Genet. 2017 May 29;8:70. doi: 10.3389/fgene.2017.00070. eCollection 2017. 10.3389/fgene.2017.00070 PubMed 28611824