Skip to main content
Addgene

4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
(Plasmid #68356)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68356 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Amp
  • Backbone size w/o insert (bp) 2500
  • Total vector size (bp) 8005
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
  • gRNA/shRNA sequence
    PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
  • Species
    Synthetic
  • Insert Size (bp)
    1059
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NruI (unknown if destroyed)
  • 3′ cloning site SpeI (unknown if destroyed)
  • 5′ sequencing primer ttttggcaagtcagttaggaca
  • 3′ sequencing primer GGAATGGTAGATGTTTAAAC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    FlpO recombinase
  • gRNA/shRNA sequence
    -----
  • Species
    Synthetic
  • Insert Size (bp)
    1300
  • Promoter Synthetic Probasin ARRx2
  • Tag / Fusion Protein
    • mTurquoise2 (BFP) (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (unknown if destroyed)
  • 3′ cloning site PacI (unknown if destroyed)
  • 5′ sequencing primer ttttggcaagtcagttaggaca
  • 3′ sequencing primer GGAATGGTAGATGTTTAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 68356 ; http://n2t.net/addgene:68356 ; RRID:Addgene_68356)