Skip to main content
Addgene

AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
(Plasmid #68346)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68346 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Amp
  • Backbone size w/o insert (bp) 2500
  • Total vector size (bp) 6200
  • Vector type
    Mammalian Expression, AAV ; Flp/Frt

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    3xgRNA;PTENA, p53B,SMAD4A
  • Species
    Synthetic
  • Insert Size (bp)
    1050
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer ttcgccacctctgacttgag
  • 3′ sequencing primer gggcgtacttggcatatgat
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    FlPO
  • Species
    Synthetic
  • Insert Size (bp)
    1300
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site AflII (unknown if destroyed)
  • 5′ sequencing primer tcctacttggcagtacatct
  • 3′ sequencing primer atcagcaaggagatgatcgc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 68346 ; http://n2t.net/addgene:68346 ; RRID:Addgene_68346)

  • For your References section:

    The CRISPR/Cas9 Minipig-A Transgenic Minipig to Produce Specific Mutations in Designated Tissues. Berthelsen MF, Riedel M, Cai H, Skaarup SH, Alstrup AKO, Dagnaes-Hansen F, Luo Y, Jensen UB, Hager H, Liu Y, Callesen H, Vendelbo MH, Jakobsen JE, Thomsen MK. Cancers (Basel). 2021 Jun 16;13(12). pii: cancers13123024. doi: 10.3390/cancers13123024. 10.3390/cancers13123024 PubMed 34208747
Related items:
Commonly requested with: