AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
(Plasmid #68346)

• Purpose: Used to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4
• Depositing Lab: Jannik Elverløv-Jakobsen
• Publication: Berthelsen et al Cancers (Basel). 2021 Jun 16;13(12). pii: cancers13123024. doi: 10.3390/cancers13123024.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: Amp
• Backbone size w/o insert (bp): 2500
• Total vector size (bp): 6200
• Vector type: Mammalian Expression, AAV ; Flp/Frt

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: 3xgRNA;PTENA, p53B,SMAD4A
• Species: Synthetic
• Insert Size (bp): 1050
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: ttcgccacctctgacttgag
• 3′ sequencing primer: gggcgtacttggcatatgat

Gene/Insert 2

• Gene/Insert name: FlPO
• Species: Synthetic
• Insert Size (bp): 1300
• Promoter: CAG

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: AflII (unknown if destroyed)
• 5′ sequencing primer: tcctacttggcagtacatct
• 3′ sequencing primer: atcagcaaggagatgatcgc

Resource Information

• Supplemental Documents:
  • AAV_med 3xgRNA_PTENA_p53B_SMAD4_A_CAG_FlpO i zhangs med synth PA
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry