Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR
(Plasmid #68345)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68345 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Amp
  • Backbone size w/o insert (bp) 2500
  • Total vector size (bp) 13400
  • Vector type
    Mammalian Expression, CRISPR ; Flp/Frt
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    puromycin
  • Species
    Synthetic
  • Insert Size (bp)
    700
  • Promoter CAG
  • Tag / Fusion Protein
    • linked to red flouresent protein gene mKateII (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site ClaI (unknown if destroyed)
  • 5′ sequencing primer gacaaagagacctacgtcga
  • 3′ sequencing primer gctcgtagaaggggaggttg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    hCas9
  • Species
    Synthetic
  • Promoter CAG
  • Tag / Fusion Protein
    • mVenus (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AsisI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer AGTACAACTACAACAGCCAC
  • 3′ sequencing primer GGTGCTGGTGTACCTCTTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 68345 ; http://n2t.net/addgene:68345 ; RRID:Addgene_68345)
  • For your References section:

    The CRISPR/Cas9 Minipig-A Transgenic Minipig to Produce Specific Mutations in Designated Tissues. Berthelsen MF, Riedel M, Cai H, Skaarup SH, Alstrup AKO, Dagnaes-Hansen F, Luo Y, Jensen UB, Hager H, Liu Y, Callesen H, Vendelbo MH, Jakobsen JE, Thomsen MK. Cancers (Basel). 2021 Jun 16;13(12). pii: cancers13123024. doi: 10.3390/cancers13123024. 10.3390/cancers13123024 PubMed 34208747