pKLV2-EF1a-Cas9Bsd-W
(Plasmid #68343)

• Purpose: Lentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the C-terminus
• Depositing Lab: Kosuke Yusa
• Publication: Tzelepis et al Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079.

Backbone

• Vector backbone: pKLV2 lentiviral vector
• Backbone size w/o insert (bp): 5783
• Total vector size (bp): 12704
• Vector type: Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EF1a-Cas9 cassette, WPRE
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 6964
• Promoter: EF1a
• Tag / Fusion Protein:
  • Cas9 fused with Flag-tag and a NLS at the N terminus and another NLS at the C terminus

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CATAATAGCAACAGACATAC

Resource Information

• Supplemental Documents:
  • Annotated GenBank file
• Articles Citing this Plasmid:
  • 21 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry