pICSL11055
(Plasmid #68252)

• Purpose: Level 1 Golden Gate Cassette: Plant kanamycin resistance cassette
• Depositing Lab: Nicola Patron
• Publication: Lawrenson et al Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7.

Backbone

• Vector backbone: pICH47732 (AddGene #48000)
• Total vector size (bp): 6278
• Vector type: Plant Expression, Synthetic Biology
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Can also be grown in Agrobacterium tumefaciens strains GV3101 and LBA4404. Will be low copy in this species.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Promoter:2x35s+5'UTR:Omega+CDS:nptII+3'UTR/terminator:Nos
• Alt name: 35S_nptII_nos
• Species: Cauliflower Mosaic Virus, Tobacco Mosaic Virus, Escherichia coli and Agrobacterium tumefaciens
• Insert Size (bp): 1906

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: GAACCCTGTGGTTGGCATGCACATAC
• 3′ sequencing primer: CTGGTGGCAGGATATATTGTGGTG

Resource Information

• Supplemental Documents:
  • pICSL11055.gb
• A portion of this plasmid was derived from a plasmid made by: This vector was assembled from backbones and parts from from the Golden Gate MoClo Plant Tool Kit (Kit # 1000000044) and The Golden Gate MoClo Plant Parts Kit (Kit # 1000000047).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry