pDGB1_omega2
(Plasmid
#68235)
-
PurposeGoldenBraid level 1 Omega plant expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68235 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDGB1_omega2
-
Backbone manufacturerself-made; derived from pGreenII generated at the JIC
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameempty vector
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer caacctctcgggcttctgga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB1_omega2 was a gift from Diego Orzaez (Addgene plasmid # 68235 ; http://n2t.net/addgene:68235 ; RRID:Addgene_68235) -
For your References section:
GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Sarrion-Perdigones A, Vazquez-Vilar M, Palaci J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D. Plant Physiol. 2013 Jul;162(3):1618-31. 10.1104/pp.113.217661 PubMed 23669743