Skip to main content
Addgene

pDGB3alpha2_35S:P19:Tnos (GB1203)
(Plasmid #68214)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68214 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pDGB3alpha2
  • Backbone manufacturer
    self-made; derived from pCambia1302 generated at the Cambia Institute
  • Vector type
    Plant Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    P19 silencing suppressor
  • Insert Size (bp)
    2052
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter 35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GGTGGCAGGATATATTGTGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

insert can be released with BsmBI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDGB3alpha2_35S:P19:Tnos (GB1203) was a gift from Diego Orzaez (Addgene plasmid # 68214 ; http://n2t.net/addgene:68214 ; RRID:Addgene_68214)

  • For your References section:

    GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Sarrion-Perdigones A, Vazquez-Vilar M, Palaci J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D. Plant Physiol. 2013 Jul;162(3):1618-31. 10.1104/pp.113.217661 PubMed 23669743
Included in kit:
Related items:
Commonly requested with: