pC4M-F2E-GFP-FKBP
(Plasmid #68058)

• Purpose: express EGFP-tagged FKBP for heterodimerization with FRB in mammalian cells
• Depositing Lab: Richard Youle
• Publication: Narendra et al Autophagy. 2010 Nov;6(8):1090-106.

Backbone

• Vector backbone: pC4M-F2E (now pHet-Mem1)
• Backbone manufacturer: ARIAD (now Clontech
• Backbone size w/o insert (bp): 5726
• Total vector size (bp): 6395
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• Species: jellyfish
• Insert Size (bp): 717
• GenBank ID: U55763.1
• Promoter: CMV
• Tags / Fusion Proteins:
  • 2xFKBP (C terminal on insert)
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CMVf: CGC AAA TGG GCG GTA GGC GTG
• 3′ sequencing primer: Bglob-intron-R: TTTGCCCCCTCCATATAACA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry