PB-EF1-IRES-NEO mutant ITR
(Plasmid
#67905)
-
PurposePiggyBac transposon encoding Neomycin resistance with inverted terminal repeat mutation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67905 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePB-EF1-IRES-NEO
-
Backbone manufacturerSystem Biosciences
- Total vector size (bp) 6892
-
Modifications to backboneInverted terminal repeats mutated from GGG>ATA
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNeoR
-
SpeciesSynthetic
-
Entrez GeneneoR (a.k.a. pSH111_227_223)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGGTTCCGCGCACATTTC
- 3′ sequencing primer CAGTCATCCTCGGCAAACTCTTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-EF1-IRES-NEO mutant ITR was a gift from Alex Kentsis (Addgene plasmid # 67905 ; http://n2t.net/addgene:67905 ; RRID:Addgene_67905) -
For your References section:
Genomic DNA transposition induced by human PGBD5. Henssen AG, Henaff E, Jiang E, Eisenberg AR, Carson JR, Villasante CM, Ray M, Still E, Burns M, Gandara J, Feschotte C, Mason CE, Kentsis A. Elife. 2015 Sep 25;4. pii: e10565. doi: 10.7554/eLife.10565. 10.7554/eLife.10565 PubMed 26406119