Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLNCX2 ER:ras
(Plasmid #67844)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 67844 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLNCX2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6100
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ER1a H-RasG12V fusion
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    1600
  • Mutation
    G525R renders the HBD largely insensitive to 17ß‐estradiol at concentrations less than 100 nM but does not abrogate its responsiveness to the synthetic ligand 4‐hydroxytamoxifen
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Viola Borgdorff, David Beach's Lab @ QMUL
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid encodes murine ER1a fused to human H-RasG12V.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLNCX2 ER:ras was a gift from Masashi Narita (Addgene plasmid # 67844 ; http://n2t.net/addgene:67844 ; RRID:Addgene_67844)
  • For your References section:

    Autophagy mediates the mitotic senescence transition. Young AR, Narita M, Ferreira M, Kirschner K, Sadaie M, Darot JF, Tavare S, Arakawa S, Shimizu S, Watt FM, Narita M. Genes Dev. 2009 Apr 1;23(7):798-803. doi: 10.1101/gad.519709. Epub 2009 Mar 11. 10.1101/gad.519709 PubMed 19279323