pSG5-mEKLF
(Plasmid
#67838)
-
PurposeExpression of murine EKLF (nucleotides 71-1215) driven by SV40 promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67838 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSG5
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4076
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEKLF
-
SpeciesM. musculus (mouse)
-
Entrez GeneKlf1 (a.k.a. Eklf, Nan)
- Promoter SV40
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer SV40pro-F2 (CCCCATGGCTGACTAATTTTT)
- 3′ sequencing primer SV40 poly A Reverse (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG5-mEKLF was a gift from James Bieker (Addgene plasmid # 67838 ; http://n2t.net/addgene:67838 ; RRID:Addgene_67838) -
For your References section:
A novel, erythroid cell-specific murine transcription factor that binds to the CACCC element and is related to the Kruppel family of nuclear proteins. Miller IJ, Bieker JJ. Mol Cell Biol. 1993 May;13(5):2776-86. PubMed 7682653