ML1Nmut_in_pEGFP-C1
(Plasmid #67796)

• Purpose: Mammalian expression vector driving Mouse ML1Nwt (2xML1N domain 7Q mutant version) fused to EGFP
• Depositing Lab: Rob Parton
• Publication: Ariotti et al Dev Cell. 2015 Nov 23;35(4):513-25. doi: 10.1016/j.devcel.2015.10.016. Epub 2015 Nov 12.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 5182
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ML1N*2(7Q)-EGFP
• Species: Synthetic
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: EGFP-C
• 3′ sequencing primer: RZPD Sugano R1 (CAGGTTCAGGGGGAGGTGTGG)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry