pEGFP-C1-Cep123 (CCDC123/Cep89)
(Plasmid
#67787)
-
PurposeThis plasmid encodes EGFP fused to the N-terminus of isoform 1 of Cep123 (CCDC123/Cep89)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67787 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Total vector size (bp) 7068
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCep123
-
Alt nameCCDC123
-
Alt nameCep89
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2352
-
GenBank IDNM_032816
-
Entrez GeneCEP89 (a.k.a. CCDC123, CEP123)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sal I (not destroyed)
- 3′ cloning site BamH I (not destroyed)
- 5′ sequencing primer GFP 3' Fw (TTCGTGACCGCCGCCGGGATCA) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-Cep123 (CCDC123/Cep89) was a gift from Michel Bornens (Addgene plasmid # 67787 ; http://n2t.net/addgene:67787 ; RRID:Addgene_67787) -
For your References section:
Primary ciliogenesis requires the distal appendage component Cep123. Sillibourne JE, Hurbain I, Grand-Perret T, Goud B, Tran P, Bornens M. Biol Open. 2013 Apr 9;2(6):535-45. doi: 10.1242/bio.20134457. Print 2013 Jun 15. BIO20134457 [pii] PubMed 23789104