Kohinoor-H2B/pcDNA3
(Plasmid
#67774)
-
PurposeHiston2B-targetted Kohinoor for mammalian cell expression
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67774 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKohinoor
-
SpeciesSynthetic
-
Insert Size (bp)675
-
GenBank IDAB935555
- Promoter CMV
-
Tag
/ Fusion Protein
- H2B (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GAAATTAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Kohinoor-H2B/pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 67774 ; http://n2t.net/addgene:67774 ; RRID:Addgene_67774) -
For your References section:
A fast- and positively photoswitchable fluorescent protein for ultralow-laser-power RESOLFT nanoscopy. Tiwari DK, Arai Y, Yamanaka M, Matsuda T, Agetsuma M, Nakano M, Fujita K, Nagai T. Nat Methods. 2015 Jun;12(6):515-8. doi: 10.1038/nmeth.3362. Epub 2015 Apr 20. 10.1038/nmeth.3362 PubMed 25894946
Map uploaded by the depositor.