Pr-delRBS-deGFP
(Plasmid
#67744)
-
PurposePr promoter expressing a deGFP that is missing a ribosomal binding site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBEST
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2453
- Total vector size (bp) 3167
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)KL740
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedeGFP-T500
-
SpeciesSynthetic
-
Insert Size (bp)714
- Promoter OR2-OR1-Pr
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGTGGGCTAACGATATCCG
- 3′ sequencing primer GGAGCTGACTGGGTTGAAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pr-delRBS-deGFP was a gift from Richard Murray (Addgene plasmid # 67744 ; http://n2t.net/addgene:67744 ; RRID:Addgene_67744) -
For your References section:
Gene circuit performance characterization and resource usage in a cell-free "breadboard". Siegal-Gaskins D, Tuza ZA, Kim J, Noireaux V, Murray RM. ACS Synth Biol. 2014 Jun 20;3(6):416-25. doi: 10.1021/sb400203p. Epub 2014 Apr 7. 10.1021/sb400203p PubMed 24670245