Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Pr2-deGFP-MGapt
(Plasmid #67736)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67736 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBEST
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 2453
  • Total vector size (bp) 3261
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    UTR1-deGFP-MGapt-T500
  • Species
    Synthetic
  • Insert Size (bp)
    808
  • Promoter OR2-OR1-Pr2

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGGTGGGCTAACGATATCCG
  • 3′ sequencing primer GGAGCTGACTGGGTTGAAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pr2-deGFP-MGapt was a gift from Richard Murray (Addgene plasmid # 67736 ; http://n2t.net/addgene:67736 ; RRID:Addgene_67736)
  • For your References section:

    Gene circuit performance characterization and resource usage in a cell-free "breadboard". Siegal-Gaskins D, Tuza ZA, Kim J, Noireaux V, Murray RM. ACS Synth Biol. 2014 Jun 20;3(6):416-25. doi: 10.1021/sb400203p. Epub 2014 Apr 7. 10.1021/sb400203p PubMed 24670245