pECTO
(Plasmid #67683)

• Purpose: (Empty Backbone) pMAD2 derivative designed for chromosomal gene ectopic complementation in Staphylococcus aureus
• Depositing Lab: Philippe Bouloc
• Publication: pMAD derivatives (unpublished)

Backbone

• Vector backbone: pMAD2
• Modifications to backbone: pECTO a Gram negative/Gram positive shuttle vector derived from pMAD2 designed to integrate DNA sequences between SAOUHSC_00278 and SAOUHSC_00279 (NCTC8325 nomenclature HG003). It carries about 1kb of both sequences. A terminator introduced between the SAOUHSC_00278 and SAOUHSC_00279 sequences prevents polar effects associated with the expression of inserted genes.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: This a Gram negative/Gram positive shuttle vector with two specialized replicons and antibiotic markers. pBR322 replicon and ampicillin resistance for E. coli. pE194(ts) replicon and erythromycin resistance for S. aureus. In S. aureus, the plasmid propagates at T<30°C, it becomes a suicide vector at T>37°C.
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCCCAATATAATCATTTATCAACTCT
• 3′ sequencing primer: TCTACCTGCCTGGACAGCAT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pECTO can be used for ectopic complementation or any chromosomal gene insertions in S. aureus. It allows insertions between SAOUHSC_00278 and SAOUHSC_00279, a conserved region with no detected transcription. DNA sequences are inserted in pECTO using the unique ClaI and SalI restriction sites or more practically by Gibson assembly method. pECTO derives from pMAD2.