Cav1-miniSOG
(Plasmid
#67667)
-
PurposeMammalian expression vector driving dog Caveolin1-minSOG
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67667 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDog Cav1-miniSOG
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CMV_F2seq (cgtgtacggtgggaggtcta) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cav1-miniSOG was a gift from Rob Parton (Addgene plasmid # 67667 ; http://n2t.net/addgene:67667 ; RRID:Addgene_67667) -
For your References section:
Modular Detection of GFP-Labeled Proteins for Rapid Screening by Electron Microscopy in Cells and Organisms. Ariotti N, Hall TE, Rae J, Ferguson C, McMahon KA, Martel N, Webb RE, Webb RI, Teasdale RD, Parton RG. Dev Cell. 2015 Nov 23;35(4):513-25. doi: 10.1016/j.devcel.2015.10.016. Epub 2015 Nov 12. 10.1016/j.devcel.2015.10.016 PubMed 26585296